lista de genética 02

Páginas: 3 (687 palavras) Publicado: 26 de setembro de 2014
Genética - 2ª Lista de Exercícios!
Síntese Protéica!

!

1. Compare e contraste a replicação, a transcrição e a tradução de procariontes e
eucariontes?!

!

2. Considere o segmento de fitade DNA abaixo:!
3’ AAAGAACGATGATTTCGGATTT 5’!
a) Qual a seqüência de bases do RNAm correspondentes?!
b) Quais os anti-códons dos tRNAs acima considerados?!
c) Qual a seqüência de aminoácidoscodificados pelo RNAm?!

!

3. Uma única adição de nucleotídeos e uma deleção aproximadamente 15 pontos
distantes do DNA causam a mudança na seqüência de uma proteína de:!
LYS – SER – PRO – SER – LEU –ASN – ALA – ALA – LYS para!
LYS – VAL – HIST – HIST – LEU – MET – ALA – ALA – LYS!
a) Quais as seqüências de nucleotídeos do RNA velho e do novo?!
b) Que tipo de RNA é?!
c) Qual o nucleotídeo quefoi deletado e qual foi adicionado?!

!
4. Porque apenas 61 trincas (seqüências de nucleotídeos) codificam aminoácidos?!
!

5. Considere a seqüência de bases nitrogenadas abaixo como parte de umamolécula de
acido nucléico: 5’ UGA – AUG 3’!
a) De que acido nucléico ela faz parte?!
b) Quais os outros ácidos nucléicos relacionados com tal seqüência e suas respectivas
bases nitrogenadas?!
c)Se a seqüência dada resultar um segmento de proteína, quais os aminoácidos que
estariam presentes?!

!
6. Como a transcrição é iniciada e terminada?!
!

7. Considerando-se a seqüência decódons 5’ AUG CGA 3’ responda justificando:!
a) De que molécula o ácido nucléico faz parte?!
b) Qual o anti-códon correspondente?!
c) De que molécula a resposta b) faz parte?!
d) Qual é a seqüênciatemplate (sense ou molde) correspondente?!
e) e a não templante?!
f) A que molécula as duas ultimas respostas pertencem?!

!

8. Moléculas de rRNA são relativamente estáveis, enquanto que o mRNA édegradado
rápidamente.!
Discuta possíveis causas e conseqüências desse fato.!

!
9. Diga o que você sabe sobre as fitas sense e anti-sense do DNA.!
!
10. Discuta as principais características...
Ler documento completo

Por favor, assinar para o acesso.

Estes textos também podem ser interessantes

  • lista de genetica
  • lista genética
  • Lista genetica
  • LISTA GENÉTICA
  • Lista genetica
  • Lista 02
  • Lista de exercicios genetica ufs
  • LISTA 1 DE REVIS O GENETICA

Seja um membro do Trabalhos Feitos

CADASTRE-SE AGORA!