genética

Páginas: 2 (273 palavras) Publicado: 9 de setembro de 2013
UNIVERSIDADE ANHANGUERA UNIDERP
Câmpus Agrárias

2ª LISTA DE ATIVIDADES
BIOLOGIA MOLECULAR – NATUREZA QUÍMICA DO MATERIAL GENÉTICO
RESPONSÁVEL: Profa. Dra. Giselle FelicianiBarbosa.
DISCIPLINA: Genética na Agropecuária.

DATA: 12 de agosto de 2013.

1) Conceitue:
a - DNA;
b - RNA;
c - Nucleotídeo;
d - Gene;
e - Duplicação semi-conservativa;
f -Transcrição;
g - Tradução;
h - Éxons;
i - Íntrons.
2) Para decifrar o código genético, pesquisadores utilizaram mRNAs sintéticos de constituição conhecida e,
com estes, sintetizaram as cadeiaspolipeptídicas. Suponha que foram obtidos os seguintes resultados com
esse tipo de estudo:
mRNAs sintéticos
N° de aminoácidos diferentes na proteína
AGAGAGAGAGAGAGAGAGAGAGAG
2UUUUUUUUUUUUUUUUUUUUUUUU
1
AGACAGACAGACAGACAGACAGACAGA
4
Que conclusão pode ser tirada com relação ao número de bases que codificam os aminoácidos?
3) Considere a sequência de basesnitrogenadas do DNA onde se insere um gene estrutural hipotético.
5’ CGATTAATGAATGTCAAATATCATTGAGTAGGGCATCCC 3’  cadeia senso (fita de DNA codificadora)
3’ GCTAATTAC TTACAGTTTATAGTAACTCATCCCGTAGGG 5’  cadeia antissenso (fita molde de DNA)
a - Qual é o sentido de crescimento da cadeia polinucleotídica crescente durante a duplicação?
b - Qual seria a sequência de bases domRNA resultante da transcrição da cadeia polinucleotídica do DNA,
fita molde?
c - Quantos códons esse mRNA possuiria?
d - Qual seria o primeiro códon a ser sintetizado nesse mRNA?
e- Qual seria a sequência de aminoácidos (aa) do polipeptídeo traduzido a partir deste mRNA?
4) A composição de bases de vários ácidos nucleicos isolados de algumas espécies é fornecida aseguir:
Bases
Espécie
A
C
G
T
U
1
20
30
30
20
2
40
10
10
40
3
30
30
20
20
4
40
10
40
10
Para cada espécie, caracterize o ácido nucleico encontrado.

Ler documento completo

Por favor, assinar para o acesso.

Estes textos também podem ser interessantes

  • genetica
  • genetica
  • genetica
  • Genetica
  • Genetica
  • Genetica
  • Genetica
  • genetica

Seja um membro do Trabalhos Feitos

CADASTRE-SE AGORA!