Bióloga

Páginas: 5 (1167 palavras) Publicado: 21 de novembro de 2013
RELATÓRIO DE AULA PRÁTICA
GENBANK





SÃO PAULO
2013
INTRODUÇÃO

Todas as atividades de um organismo são controladas pela regulação da expressão dos genes. A identificação dos genes expressos pode auxiliar na compreensão do metabolismo, por exemplo. Entre as técnicas moleculares para identificação de genes encontra-se a que utiliza cDNA, que possibilita uma rápida determinação dogene.
A síntese de cDNA é feita pela enzima transcriptase reversa, de origem viral, que produz uma molécula de DNA dupla fita, a partir da cópia de uma molécula de mRNA. Uma biblioteca de cDNA pode ser utilizada para clonar um gene de interesse, pois o isolamento do gene é significativamente mais simples do que em bibliotecas genômicas. Também é possível deduzir a sequência dos aminoácidos quecomporão a proteína.
Em 1988 o governo americano lançou o primeiro banco de dados público contendo sequências de DNA, que recebeu o nome de Centro Nacional para Informação em Biotecnologia (NCBI), e hoje possui divisões no mundo inteiro, proporcionando banco de dados e ferramentas de bioinformática. O depósito e análise de sequências no banco de dados possibilita a manipulação e apreciação destas,utilizando softwares especiais.
Os bancos de dados públicos possibilitam o acesso à informação procedente de locais distintos, bem como troca e compartilhamento de sequências genéticas. O banco do NCBI é denominado GenBank.
Dentro do NCBI, é possível realizar a pesquisa BLAST (Basic Local Alignment Search Tool). Trata-se de um algoritmo que compara informações de sequências biológicas primárias,como sequência de aminoácidos de uma proteína, ou sequência de nucleotídeos de DNA. A pesquisa Blast permite a comparação da sequência fornecida na consulta, com a base dados, identificando as bibliotecas de sequências que se assemelham à consultada, exibindo o grau de semelhança.
A comparação de sequências é necessária para encontrar similaridades entre elas, possibilitando a construção defamílias de proteínas e o entendimento da filogenia do gene. A comparação é realizada a partir do alinhamento entre as sequências, avaliado por um sistema de pontuação, expressando uma porcentagem de identidade, que é uma medida da similaridade entre as sequências.


OBJETIVOS

Executar os procedimentos para análise de sequências genéticas.
Analisar a sequência de cDNA e realizar suatradução.
Identificar e analisar a sequência de DNA genômico.
Realizar o alinhamento entre cDNA e DNA genômico e analisá-lo.








MATERIAL E MÉTODOS

A sequência de cDNA a ser analisada foi fornecida pelo professor. As análises foram realizadas através dos sites NCBI (www.ncbi.nlm.nih.gov), e Expasy (http://www.expasy.ch/tools/dna.html).









RESULTADOS

01 – Sequênciade cDNA.
CGGAAGGGGAAGGGGGTGGAGGTTGCTGCTATGAGAGAGAAAAAAAAAACAGCCACAATA-
GAGATTCTGCCTTCAAAGGTTGGCTTGCCACCTGAAGCAGCCACTGCCCAGGGGGTGCAA-
AGAAGAGACAGCAGCGCCCAGCTTGGAGGTGCTAACTCCAGAGGCCAGCATCAGCAACTG-
GGCACAGAAAGGAGCCGCCTGGGCAGGGACCATGGCACGGCCACATCCCTGGTGGCTGTG-
CGTTCTGGGGACCCTGGTGGGGCTCTCAGCTACTCCAGCCCCCAAGAGCTGCCCAGAGAG-
GCACTACTGGGCTCAGGGAAAGCTGTGCTGCCAGATGTGTGAGCCAGGAACATTCCTCGT-GAAGGACTGTGACCAGCATAGAAAGGCTGCTCAGTGTGATCCTTGCATACCGGGGGTCTC-
CTTCTCTCCTGACCACCACACCCGGCCCCACTGTGAGAGCTGTCGGCACTGTAACTCTGG-
TCTTCTCGTTCGCAACTGCACCATCACTGCCAATGCTGAGTGTGCCTGTCGCAATGGCTG-
GCAGTGCAGGGACAAGGAGTGCACCGAGTGTGATCCTCTTCCAAACCCTTCGCTGACCGC-
TCGGTCGTCTCAGGCCCTGAGCCCACACCCTCAGCCCACCCACTTACCTTATGTCAGTGA-
GATGCTGGAGGCCAGGACAGCTGGGCACATGCAGACTCTGGCTGACTTCAGGCAGCTGCC-TGCCCGGACTCTCTCTACCCACTGGCCACCCCAAAGATCCCTGTGCAGCTCCGATTTTAT-
TCGCATCCTTGTGATCTTCTCTGGAATGTTCCTTGTTTTCACCCTGGCCGGGGCCCTGTT-
CCTCCATCAACGAAGGAAATATAGATCAAACAAAGGAGAAAGTCCTGTGGAGCCTGCAGA-
GCCTTGTCGTTACAGCTGCCCCAGGGAGGAGGAGGGCAGCACCATCCCCATCCAGGAGGA-
TTACCGAAAACCGGAGCCTGCCTGCTCCCCCTGAGCCAGCACCTGCGGGAGCTGCACTAC-
AGCCCTGGCCTCCACCCCCACCCCGCCGACCATCCAAGGGAGAGTGAGACCTGGCAGCCA-
CAACTGCAGTCCCATCCTCTTGTCAGGGCCCTTTCCTGTGTACACGTGACAGAGTGCCTT-...
Ler documento completo

Por favor, assinar para o acesso.

Estes textos também podem ser interessantes

  • Bióloga
  • Biologa
  • Biológa
  • Bióloga
  • Biologa
  • Biologa
  • biologa
  • Bióloga

Seja um membro do Trabalhos Feitos

CADASTRE-SE AGORA!