Quimica geral

Páginas: 2 (286 palavras) Publicado: 16 de outubro de 2011
Atividades de Biologia Celular
Profª Elizabeth Mitsue Hachiya Saud
As questões deverão ser entregues até o dia 21 de setembro. Poder-se-á realizar em dupla, deverá ser entregueimpresso ou manuscrito. Valor: 10 pontos.

1. A PCR é um método que permite sintetizar, em poucas horas e in vitro, uma grande quantidade de um determinado fragmento de DNA. Nasequencia abaixo, desenhe um oligonucleotídeo a fim de sintetizar um par de primers para a reação, relate se o local escolhido é proveniente um éxon ou íntron (use a sua imaginação), ou“híbrido”, explique porque a opção pela localização (seja convincente) e dê o tamanho do fragmento a ser amplificado. (2 pontos)TCAGGGGGGGATTGTCTCTGGGTTGTGTTCCTCGAGGAGAGGGGGTTGTGGCCTGCATGG

2. Ainda, a partir da sequência acima citada, de que forma poderíamos saber de que espécie ela pertence? (1 ponto)3. A acadêmica Vanusia, proveniente da cidade de Arinos, obteve uma solução para ser avaliada. De que forma (na prática) poderíamos identificar a natureza desta substância, sem ternoção alguma sobre a procedência da mesma? (1 ponto)
4. A eletroforese é um termo bastante amplo, que se refere à migração de solutos e partículas em um meio líquido, sob influência deum campo magnético. Para análise de proteínas, qual a opção que se fez, em relação à composição do gel, analisando o desenho abaixo? Porque da escolha? Como foi revelado? O quecorresponde: nº1 e as bandas em evidência? (2 pontos)

5. Analisando o desenho abaixo, descreva os processos de contração e relaxamento do sarcômero em termos de proteínas.(2 pontos)
6. Descreva, em linhas gerais, o processo de Meiose: (1 ponto)
7. Estabeleça uma relação entre o Ciclo Celular X Processo Oncogênico. (1 ponto)
Ler documento completo

Por favor, assinar para o acesso.

Estes textos também podem ser interessantes

  • Quimica geral
  • Quimica geral
  • quimica geral
  • Quimica Geral
  • Quimica Geral
  • quimica geral
  • quimica geral

Seja um membro do Trabalhos Feitos